The Reynolds Lab @ UNC Asheville

reynol 

The Reynolds Lab uses laboratory genetic, field-based, and computational techniques to study the evolution and conservation of vertebrates on islands. Most of our work is on reptiles in the Caribbean, particularly in the Bahamas, Turks & Caicos, and Puerto Rico.

 

 

alsg_logo300picture1  graphical-abstract-150x150  Picture3

Previous Affiliations:
 Harvard-seal-3  MCZ Logo 4d.sm umb centeredlogo-500 Duke_University_Crest.svg

What’s New:

Two grants came in this week which will fund various projects for the next several years. A collaborative sub award (with the San Diego Zoo) will fund fieldwork on Turks Island Boas for the next several years.

A collaborative grant from the International Iguana Foundation (with colleagues from Earlham College, the Ft. Worth Zoo, and the Shedd Aquarium) will fund our project estimating species diversity and evolutionary relationships among highly threatened West Indian Rock Iguanas.

November 30 2016

tattatccatattacccgagacgtcccatacggatgactaatacaaaatcttcacgccattggagcctcaatattct

Looking forward to giving a seminar at the University of Georgia this week

images

November 18 2016

tattatccatattacccgagacgtcccatacggatgactaatacaaaatcttcacgccattggagcctcaatattcttc

Talking about Silver Boas and Biodiversity at Carolina Day School this week

14902693_648943211953985_2038089579894715175_o

October 27 2016

tattatccatattacccgagacgtcccatacggatgactaatacaaaatcttcacgccattggagcctcaatattcttc

This week I’ll be giving a seminar at Mississippi State University

index

September 30 2016

tattatccatattacccgagacgtcccatacggatgactaatacaaaatcttcacgccattggagcctcaatattcttc

Silver Boa featured on UNC Asheville’s homepage this week

unca-homepage

September 2016

tattatccatattacccgagacgtcccatacggatgactaatacaaaatcttcacgccattggagcctcaatattcttc

Two new publications from Reynolds Lab member Ari Miller: Biology of the Asian Common Mockviper (Miller and Zug 2016, Proc. Biol. Soc. Wash.) and An Enigmatic Writhing Skink from Myanmar (Miller and Zug 2016, Herp. Rev.).

  September 2016

tattatccatattacccgagacgtcccatacggatgactaatacaaaatcttcacgccattggagcctcaatattcttc

Research by Reynolds Lab member Robert Chambliss is featured on UNC Asheville’s homepage this week

Screenshot 2016-08-27 09.52.54

  August 2016

tattatccatattacccgagacgtcccatacggatgactaatacaaaatcttcacgccattggagcctcaatattcttcattt

New Blog Post: Anole Surveys on the Cay Sal Bank, Bahamas

  August 2016

tattatccatattacccgagacgtcccatacggatgactaatacaaaatcttcacgccattggagcctcaatattcttcattt

Another Evolution paper: “Ecological specialization and morphological diversification in Greater Antillean boas” is online early

June 2016

tattatccatattacccgagacgtcccatacggatgactaatacaaaatcttcacgccattggagcctcaatattcttcattt


Popular press coverage from our recent paper describing the Silver Boa, Chilabothrus argentum, published in the journal Breviora

Silver_Boa

Asheville Citizen Times 1, 2; WLOS; UNC TV; National Geographic; The Guardian; The Independent; El Nuevo Dia; El Mundo; BBC Science Focus; CS Monitor; Newsweek; Jamaica Observer; The Nassau Guardian; Univision Noticias; La Nacion Costa Rica; Scientific American; etc.

May 2016

tattatccatattacccgagacgtcccatacggatgactaatacaaaatcttcacgccattggagcctcaatattcttcattt

New Blog Post: Carrot Rock, BVI and the Endemic Anolis ernestwilliamsi

May 2016

tattatccatattacccgagacgtcccatacggatgactaatacaaaatcttcacgccattggagcctcaatattcttcattt

Our paper on urban adaptation in anoles is the cover of Evolution this month

13221551_10100616712834402_6004522890419248733_n

May 2016

tattatccatattacccgagacgtcccatacggatgactaatacaaaatcttcacgccattggagcctcaatattcttcattt

Reynolds Lab members Shannon Bodeau and Amy Castle have been awarded Summer Research Grants from UNC Asheville. Stay tuned for updates on their work!

May 2016

tattatccatattacccgagacgtcccatacggatgactaatacaaaatcttcacgccattggagcctcaatattcttcattt

New paper in Evolution with former lab mates in the Revell Lab at UMass Boston and Losos Lab at Harvard. Urban evolutionary ecology in Puerto Rican Anolis lizards. Congrats to lead author Kristin Winchell. Coverage in New Scientist and IFLScience.

March 2016

tattatccatattacccgagacgtcccatacggatgactaatacaaaatcttcacgccattggagcctcaatattcttcattt

Congrats to Reynolds Lab member Robert Chambliss, who has been awarded a McCullough Fellowship to study high elevation plethodontid salamanders.
March 2016

tattatccatattacccgagacgtcccatacggatgactaatacaaaatcttcacgccattggagcctcaatattcttcattt

Four recently accepted papers in the Biological Journal of the Linnean Society (evolution in island and mainland Anoles), Breviora (a new species of West Indian boa), Copeia (natural history of cave salamanders), and IRCF Reptiles & Amphibians (new herpetofaunal records from the Bahamas).
January 2016

tattatccatattacccgagacgtcccatacggatgactaatacaaaatcttcacgccattggagcctcaatattcttcattt

I am thrilled to be joining the faculty of the Department of Biology, University of North Carolina Asheville in January 2016 as an Assistant Professor of Biology. 

unca_logo
March 2015

tattatccatattacccgagacgtcccatacggatgactaatacaaaatcttcacgccattggagcctcaatattcttcattt

Recently accepted papers in the Journal of Herpetology, Evolution, and Global Ecology and Conservation. Themes are Aruba Boa constrictor genetics, Anolis lizards + locate.yeti, and conservation genetics of Virgin Islands boas. 
February 2015

tattatccatattacccgagacgtcccatacggatgactaatacaaaatcttcacgccattggagcctcaatattcttcattt

New paper in Science (rapid phenotypic evolution).
Coverage in Washington Post, NY Times, The Scientist Magazine, Harvard Gazette, etc.

October 2014

tattatccatattacccgagacgtcccatacggatgactaatacaaaatcttcacgccattggagcctcaatattcttcattt

I am excited to be joining the Journal of Herpetology as an Associate Editor and Herpetological Conservation and Biology as an Assistant Editor.
August 2014

tattatccatattacccgagacgtcccatacggatgactaatacaaaatcttcacgccattggagcctcaatattcttcattt

My undergraduate mentee received the Hoopes Prize for his senior thesis investigating phylogeography in the Puerto Rican Crested Anole.
April 2014

tattatccatattacccgagacgtcccatacggatgactaatacaaaatcttcacgccattggagcctcaatattcttcattt

I am looking forward to giving talks this week at the Museum of Comparative Zoology and the University of Rhode Island on “Evolution and Diversification of Boas: Micro to Macro Scale.”
March 2014

tattatccatattacccgagacgtcccatacggatgactaatacaaaatcttcacgccattggagcctcaatattcttcattt

untitled

Our paper on the Boa and Python Tree-of-Life is in the latest issue of Molecular Phylogenetics and Evolution
February 2014

tattatccatattacccgagacgtcccatacggatgactaatacaaaatcttcacgccattggagcctcaatattcttcattt

Field expeditions to the Turks and Caicos and Dominican Republic this month have yielded 153 boa samples from 3 species!
September/October 2013

tattatccatattacccgagacgtcccatacggatgactaatacaaaatcttcacgccattggagcctcaatattcttcattt

The Inaugural Caribbean and Latin American Boa Group meeting in Arecibo, Puerto Rico was a great success, with attendees from 16 institutions and 5 countries
August 2013

tattatccatattacccgagacgtcccatacggatgactaatacaaaatcttcacgccattggagcctcaatattcttcattt

Two new manuscripts out: phylogenetics of the West Indian Boas (Molecular Phylogenetics & Evolution) and population genetics of Puerto Rican boas (PLoS ONE)
May 2013

tattatccatattacccgagacgtcccatacggatgactaatacaaaatcttcacgccattggagcctcaatattcttcattt


The Reptiles of Tennessee (summer 2013) and The Amphibians of Tennessee (2011). A dream finally realized thanks to my co-editors Matt Niemiller and Brian Miller.

tattatccatattacccgagacgtcccatacggatgactaatacaaaatcttcacgccattggagcctcaatattcttcattt

Finally! The first study of the natural history of the Turks Island Boa is in the current issue of the Journal of Herpetology.

tattatccatattacccgagacgtcccatacggatgactaatacaaaatcttcacgccattggagcctcaatattcttcattt

Our paper (with Alberto Puente-Rolon, Bob Reed, and Liam Revell) on invasive Boa constrictors in western Puerto Rico was written up as a top story on Live Science and picked up by CBS News, Yahoo News, Discovery News, EarthSky, and NBC News, among others.

tattatccatattacccgagacgtcccatacggatgactaatacaaaatcttcacgccattggagcctcaatattcttcattt

Alberto, Liam, and I just returned from field work on Long Island, Bahamas. See pictures on my photos page.

tattatccatattacccgagacgtcccatacggatgactaatacaaaatcttcacgccattggagcctcaatattcttcattt

Three recently accepted papers in Evolution (population genetics of cave fish), Genetica (in silico population genetics), and Biological Invasions (invasive species genetics).

tattatccatattacccgagacgtcccatacggatgactaatacaaaatcttcacgccattggagcctcaatattcttcattt

A paper with my postdoc mentor Liam Revell
made the cover of the latest issue of Evolution

tattatccatattacccgagacgtcccatacggatgactaatacaaaatcttcacgccattggagcctcaatattcttcattt

Attention undergrad students- we are teaching a new winter term course: Biol 381: Special Topics: Caribbean Tropical Biology and Conservation   -> more info

See you in Puerto Rico!

tattatccatattacccgagacgtcccatacggatgactaatacaaaatcttcacgccattggagcctcaatattcttcattt

I have received a grant from the US Fish and Wildlife Service Endangered Species Recovery program for my work with Alberto Puente-Rolon and Liam Revell on conservation genetics of the Puerto Rican Boa

tattatccatattacccgagacgtcccatacggatgactaatacaaaatcttcacgccattggagcctcaatattcttcattt

Our next book, The Reptiles of Tennessee, sister volume to The Amphibians of Tennessee, was accepted on 1-27-12 and is now in production. Look for it in early 2013.

tattatccatattacccgagacgtcccatacggatgactaatacaaaatcttcacgccattggagcctcaatattcttcattt

The Revell Lab had a successful trip to Puerto Rico- stay tuned for updates on our projects with the Puerto Rican Boa (Epicrates inornatus) and Boa constrictor.

tattatccatattacccgagacgtcccatacggatgactaatacaaaatcttcacgccattggagcctcaatattcttcattt

I have added a short R tutorial here. A fun way to render maps from shapefiles, and very easy!

tattatccatattacccgagacgtcccatacggatgactaatacaaaatcttcacgccattggagcctcaatattcttcattt

From UT Press: utpress.org
Dr. Joe DiPietro Receives Amphibians

Pictured in the photo, left to right: Dr. Graham Reynolds, Dr. Joseph DiPietro, Dr. Matthew Niemiller.

“University of Tennessee President Dr. Joe DiPietro recently was presented with a copy of The Amphibians of Tennessee by editors Dr. Matthew Niemiller and Dr. Graham Reynolds during their book release tour in October 2011.”

tattatccatattacccgagacgtcccatacggatgactaatacaaaatcttcacgccattggagcctcaatattcttcattt

 

Site Updated 10-28-2016

Leiocephalus psammodromus on a Melocactus intortus cephalium
Big Ambergris Cay, Turks and Caicos Islands

*What does the string of genetic sequence data represent?