Scripts and Protocols

github-bb449e0ffbacbcb7f9c703db85b1cf0b

Reynolds Lab Genotyping-By-Sequencing Protocol [download here]. This protocol is described in Quach, Reynolds, and Revell (in review).

1.1:   5’ ACACTCTTTCCCTACACGACGCTCTTCCGATCTAATGTGCA
               [bc] [SBFI overhang]
1.2:   3’ TGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGATTAC
               [RC 1.1] [RC 1.1] [RC bc]
2.1:   5’ AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG
2.2:   3’ ACGTTCTAGCCTTCTCGCCAAGTCGTCCTTACGGCTC
               [RC SBFI]

 

Please cite accordingly or contact me if these have been useful for you!

Genetic Drift Simulation R Code

 

 Citation
Reynolds, RG. 2011. Genetic drift function for R. Available @ www.rgrahamreynolds.info
Unique Genotypes Test R CodeThis test gives the 1 tailed P-value to test the fraction of replications where random draws of genotypes from a population are less than the observed number of genotypes (g). Citation

Reynolds, RG. 2011
Gene Diversity for AFLP Data R CodeThis method uses Zhivotovsky’s (1999) Bayesian estimator, which is superior to Lynch and Milligan’s (1994) method as implemented in aflp-surv 1.0 (Vekemans et al.,2002). Citation

Reynolds et al. 2012
GenBank Downloader
[1,]Epicrates_striatus_strigilatusU69795
[2,]Epicrates_striatus_strigilatusU69796
[3,]Epicrates_striatus_striatusU69797
[4,]Epicrates_striatus_striatusU69798
[5,]Epicrates_striatus_fosteriU69799
[6,]Epicrates_striatus_striatusU69800
[7,]Epicrates_striatus_fosteriU69801
[8,]Epicrates_striatus_fosteriU69802
[9,]Epicrates_subflavensU69803
R CodeThis script automatically downloads sequence data from Genbank- all you have to do is input the accession numbers. Just for fun!
simMeta R Code

A series of R scripts to simulate SSR data in structured demes (metapopulations) which undergo bottlenecks or extinction and recolonization events

Citation

Reynolds, RG. 2011
Reynolds and Fitzpatrick 2013
Decomposed Pairwise Regression R CodeConduct Decomposed Pairwise Regression analyses (Koizumi et al. 2006) for one or more datasets (multiple simulations) consisting of structured demes to identify outliers which are not in mutation-drift equilibrium. Citation

Reynolds, RG. 2011
Reynolds and Fitzpatrick 2013
Mapmaking R CodeThis is a very simple tutorial to render maps from shapefiles (.shp) in R. You can also add axes and a scale. Lots of fun to play around with, and if you have a good shapefile the maps look pretty good. If you export as a vector (i.e. non-raster) file, then you can easily color the individual components (such as counties) in programs like Illustrator. Just for fun!

R Package Development
Collaborator: Ben Fitzpatrick (UTK)

Package DPR: Reynolds 2011; Reynolds and Fitzpatrick 2011

Conduct Decomposed Pairwise Regression analyses (Koizumi et al. 2006) for one or more datasets (multiple simulations) consisting of structured demes to identify outliers which are not in mutation-drift equilibrium.

Help Files:
DPR 1 [pdf]
DPR2 [pdf]

References:
Lynch M, Milligan BG (1994) Analysis of population genetic structure with RAPD markers. Molecular Ecology 3:91-99

Reynolds, R.G. (2011) Islands, metapopulations, and archipelagos: genetic equilibrium and non-equilibrium dynamics of structured populations in the context of conservation. Ph.D. Dissertation, University of Tennessee. [pdf]

Reynolds, R.G. and B.M. Fitzpatrick (2011) DPR- a package to implement decomposed pairwise regression in an isolation by distance framework. R package version 1.0.

Reynolds, R.G. and B.M. Fitzpatrick (2013) Tests of two methods for identifying founder effects in metapopulations reveal substantial type II error. Genetica 141: 119-131

Reynolds, R.G., M.L. Niemiller, and B.M. Fitzpatrick (2012) Genetic analysis of an endemic archipelagic lizard reveals sympatric cryptic lineages and taxonomic discordance. Conservation Genetics 13: 953-963

Vekemans X, Beauwens T, Lemaire M, Roldan-Ruiz I (2002) Data from amplified fragment length polymorphism (AFLP) markers show indication of size homoplasy and of relationship between degree of homoplasy and fragment size. Molecular Ecology 11:139-151.

Zhivotovsky L (1999) Estimating population structure in diploids with multilocus dominant DNA markers. Molecular Ecology 8:907-913.